el triplete

Popularity
500+ learners.
Está constituida por tres polipéptidos diferentes, el triplete de neurofilamentos.
They consist of three distinct polypeptides, the neurofilament triplet.
¿Para qué aminoácido codifica el triplete GTT?
Which amino acid does the nucleotide triplet GTT code for?
Polarización cromosférica en el triplete infrarrojo fotosférico del oxígeno en el Sol.
Chromospheric polarization in the photospheric solar oxygen infrared triplet.
Sébastien Ogier ha encabezado el triplete de Volkswagen Motorsport después de la primera jornada del 72nd LOTOS Rallye de Polonia.
Sébastien Ogier headed a Volkswagen Motorsport 1-2-3 after Friday's opening leg of 72nd LOTOS Rally Poland.
Resultó ser un gran día de apertura para los seguidores locales, ya que Teemu Suninen completó el triplete finlandés.
It proved to be a great opening day for the home rally fans as Teemu Suninen completed a Finnish lock-out of the top-three places.
Los neurofilamentos están compuestos por tres subunidades principales, llamados el triplete de neurofilamentos, con masas moleculares de 68 kD, 160kD y 200 kD.
Neurofilaments are composed of three major subunits referred to as the neurofilament triplet, with molecular weights of 68 kD, 160kD and 200 kD.
En el Rally de Australia Volkswagen consiguió el triplete definitivo con victoria para Sebastien Ogier, segundo puesto para Jari-Matti Latvala y último cajón del podio para Andreas Mikkelsen.
The Volkswagen Rally Australia got the final triplet victory for Sebastien Ogier, second place for Jari-Matti Latvala and final step of the podium for Andreas Mikkelsen.
Neuville lideró el triplete de Hyundai, superando a Andreas Mikkelsen por 4,9 segundos, mientras que Hayden Paddon se llevó el tercer puesto, 12,1 segundos por detrás del ganador.
Neuville headed a Hyundai 1-2-3, fending off Andreas Mikkelsen by 4.9sec while Hayden Paddon surged up the order to claim third, 12.1sec off the lead.
Unirse a Barcelona en Junio 2013, en su segunda temporada en el club 2014-15, Neymar ayudó a ganar el triplete continental de la Liga, Copa del Rey y la Champions.
Joining Barcelona in June 2013, in his second season at the club in 2014-15, Neymar helped them win the continental treble of La Liga, Copa del Rey and the UEFA Champions League.
Pero el final del día el vigente campeón y ganador de la cita en 2014, Ogier (arriba) estaba en la parte superior por 2.1 segundos, seguido de Mikkelsen y Latvala, completando así el triplete de Volkswagen.
By the end of the day however defending champ, and 2014 Poland winner, Ogier (above) was on top by 2.1sec, heading Mikkelsen and Latvala in a Volkswagen 1-2-3.
Mikkelsen ha tenido una carrera limpia, pero el triplete de anoche del Hyundai Shell Mobis se ha terminado cuando el segundo mejor tiempo de Craig Breen ha situado al irlandés en tercer lugar por delante de Hayden Paddon.
Mikkelsen had a clean run but his Hyundai Shell Mobis squad's overnight 1-2-3 was interrupted when second fastest time for Craig Breen promoted the Irishman into third ahead of Hayden Paddon.
En 2003 se completó el triplete Liga ACB, Copa y Euroliga.
In 2003 it completed a Liga ACB, Cup and Euroleague treble.
Sí, ve a por el triplete, colega.
Yeah, go for the hat-trick, mate.
Sobresale el triplete de Cimmarusti, que contribuye al 8-0 en el que se concluye la primera mitad.
To note the Cimmarusti hat-trick, which contributes 8-0 on which concludes the first time.
TGTCATGCATCCGTCATCACTGAC - El triplete ATG determina el principio del mensaje y el triplete TGA, el final.
TGTCATGCATCCGTCATCACTGAC - The ATG triplet determines the beginning of the message and the TGA triplet its end.
Y luego el triplete Giro, Tour y Mundial en 1987 firmado por Stephen Roche.
In 1987, Stephen Roche scored a triple victory, winning the Giro, Tour, and World Tour.
El X30 junior vio el triplete de Edward Ludwig Villa (TB-Kart IAME), la segunda vez en la práctica.
The X30 Junior has seen the en-plein of Edoardo Ludovico Villa (TB Kart-Iame), second time in practice.
Cuenta Andrés, citado por el portal de El Tiempo, que todo empezó tras ganar con Barcelona el triplete en 2009.
Andres account, cited by the El Tiempo portal, which started after winning the triple with Barcelona in 2009.
En cualquier caso, sería un honor que ocupara mi lugar para que Raymond pueda conseguir el triplete.
In any case, I would be honored if you would take my place so that Raymond could make it a treble.
En su primera temporada con el Barça, ganó el triplete de la Liga, la Copa del Rey y la UEFA Champions League.
In his first season with Barça, he won the treble of La Liga, Copa del Rey and UEFA Champions League.
Word of the Day
luxurious